plko 1 trc lentiviral shrna system  (Addgene inc)

Journal: Nature Communications

Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control

doi: 10.1038/s41467-025-66901-7

Figure Lengend Snippet: A Immunoblot of s-EVs from mouse lung tissues after fractionation by sucrose density ultracentrifugation and probed for ALIX, GLUD1 and TOMM40. Experiment was repeated independently three times with similar results. B Transmission electron microscopy (TEM) images of s-EVs isolated from lung tissues from Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice. Scale bar, 200 nm. C Size distributions of s-EVs from lungs of Sftpc cre Gprc5a fl/fl and Sftpc cre Gprc5a wt/wt mice (means ± SEM, n = 3 replicates per group). D , E ( D ) Immunoblot of cell lysates and s-EV lysates prepared from Sftpc cre Gprc5a wt/wt and Sftpc cre Gprc5a fl/fl lungs. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. E Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 4 mice). F TEM images of s-EVs isolated from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells. Scale bar, 100 nm. G Size distributions of s-EVs from cell culture supernatants of knockdown GPRC5A (shGPRC5A-#1 and #2) or control (shCTL) A549 cells (means ± SEM, n = 3 replicates per group). H Immunoblot of cell lysates and s-EV lysates prepared from supernatants of the same number of knockdown GPRC5A (shGPRC5A #1 and #2) and control (shCTL) A549 cells. S-EVs lysates were probed for GLUD1, TOMM40 and ALIX. Cell lysates were probed for GLUD1, TOMM40, ALIX and β-actin. I Quantification of relative GLUD1 and TOMM40 densities (normalized to ALIX) in s-EVs (means ± SEM, n = 3 independent experiments). J A549 cells stably expressing MitoDsRed and GFP-CD63 were infected with GPRC5A-shRNA (shGPRC5A), or control lentiviral constructs (shCTL). S-EVs were collected from indicated culture supernatants and analyzed by flow cytometry. K Percentage of MitoDsRed + particles in all CD63 + s-EVs and ( L ) absolute number of CD63 + MitoDsRed + s-EVs (normalized to cell number) were quantified (means ± SEM, n = 3 independent experiments). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( E , I , and K – L ). Source data are provided as a Source Data file.

Article Snippet: The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid.

Techniques: Western Blot, Fractionation, Transmission Assay, Electron Microscopy, Isolation, Cell Culture, Knockdown, Control, Stable Transfection, Expressing, Infection, shRNA, Construct, Flow Cytometry, Two Tailed Test

Journal: Nature Communications

Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control

doi: 10.1038/s41467-025-66901-7

Figure Lengend Snippet: A – D A549 cells stably expressing GPRC5A-GFP were infected with DRP1-shRNA (shDRP1), MFN1-shRNA (shMFN1) or control lentiviral constructs (shCTL). A Confocal images of cells stained with Mitotracker Red. Scale bar, 5 μm. Right panel, enlarged region of interesting (ROI). Scale bar, 1 μm. B Quantification of mitochondrial morphology changes (means ± SEM, n = 10 cells). C Quantification of average mitochondrial length (means ± SEM, n = 10 cells). D Number of GPRC5A vesicles containing mitochondrial components per cell (means ± SEM, n = 10 cells). E – H A549 cells stably expressing GPRC5A-GFP were incubated with DMSO, Mdivi-1 or MFI8 for 6 h. E Confocal images of cells stained with Mitotracker Red. Scale bar, 5 μm. Right panels, enlarged ROI. Scale bar, 1 μm. F Quantification of mitochondrial morphology changes (means ± SEM, n = 9 cells). G Quantification of average mitochondrial length (means ± SEM, n = 9 cells). H Number of GPRC5A vesicles containing mitochondrial components per cell (means ± SEM, n = 9 cells). I A549 cells stably expressing GPRC5A-GFP and stained with EEA1, CD63 or LAMP1 antibodies. Scale bar, 5 μm. Lower panels, enlarged ROI. Scale bar, 1 μm. J Percentage of GPRC5A vesicles colocalized with EEA1, CD63 or LAMP1 per cell (means ± SEM, n = 10 cells). K A549 cells stably expressing MitoDsRed and GFP-CD63 were infected with GPRC5A-shRNA (shGPRC5A), or control lentiviral constructs (shCTL). Cells were imaged at 37°C with frames collected every 0.59 s. Scale bar, 5 μm. Right panel, the stills from videos showing colocalization of MitoDsRed and GFP-CD63. Scale bar, 1 μm. L Quantification of mitochondrial morphology changes (means ± SEM, n = 10 cells). M Number of contacts between MitoDsRed and GFP-CD63 positive structures per cell (means ± SEM, n = 12 cells). N Quantitative analysis of the duration of contacts (frames per punctum) (means ± SEM, n = 12 cells). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( C , D , G , H , J , M , N ). Source data are provided as a Source Data file.

Article Snippet: The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid.

Techniques: Stable Transfection, Expressing, Infection, shRNA, Control, Construct, Staining, Incubation, Two Tailed Test

Journal: Nature Communications

Article Title: Mitochondrial components secretion in extracellular vesicles promotes alveolar epithelial mitochondrial quality control

doi: 10.1038/s41467-025-66901-7

Figure Lengend Snippet: A , B Binding of GPRC5A and MIRO2. (A) HEK293T cells were transfected with S-tag-HA-GPRC5A and Flag-MIRO2 expression vectors, and cell lysates were pulled down with S-tag beads and subjected to immunoblotting with anti-Flag and anti-HA antibodies. B Cell lysates of A549 were immunoprecipitated with anti-IgG and anti-MIRO2 and immunoblotted with anti-GPRC5A and anti-MIRO2 antibodies. C , D A549 cells stably expressing GPRC5A-GFP and MIRO2-mcherry were stained with Mitotracker Deep Red (MTDR) and examined by confocal microscopy. C Distribution of the intensities of GPRC5A-GFP, MIRO2-mcherry and MTDR along the direction of the white arrow in enlarged region of interesting (ROI). Scale bar, 1 μm. D Quantification of MIRO2 intensity of cytoplastic mitochondria ( n = 100) and mitochondria inside GPRC5A vesicles ( n = 70) (means ± SEM). E-G. A549 cells stably expressing GPRC5A-GFP were infected with MIRO2-shRNA (shMIRO2) or control lentiviral constructs (shCTL). E Cells were stained with Mitotracker Red and examined by confocal microscopy. Scale bar, 5 μm. Lower panel, enlarged ROI. Scale bar, 1 μm. F Quantification of mitochondrial morphology changes (means ± SEM, n = 10 cells). G Quantitative analysis of GPRC5A vesicles containing mitochondrial components per cell (means ± SEM, n = 12 cells). H TMRM staining of Sftpc cre Gprc5a wt/wt and Sftpc cre Gprc5a fl/fl AEC2s on day 3 after PBS or GW4869 treatment as detected by flow cytometry. I Quantification of percentage of TMRM low AEC2s (means ± SEM, n = 4 mice). J Quantification of TMRM intensity in AEC2s (means ± SEM, n = 4 mice). K Schematic illustrating the formation of mitochondrial components-containing endosomal vesicles through the GPRC5A-MIRO2 pathway, created in BioRender. Han, Y. ( https://BioRender.com/bygo2rn ). Statistical significance was assessed using a two-tailed unpaired Student’s t test in ( D , G ). Statistical significance was assessed using a two-way ANOVA followed by Tukey’s multiple comparisons test in ( I , J ). Source data are provided as a Source Data file.

Article Snippet: The pLKO.1-TRC lentiviral shRNA system (Addgene, pLKO.1-TRC.mKO2, Plasmid #85208) was used for knockdown. shRNA targeting sequence for human GPRC5A : (#1: GCTGCCTACTCAGTTTCTCTT, #2: GCCCTTAATCTTGCTGTTATT), murine Gprc5a : (#1: CCTCATTTACGTGCTCGTCTT, #2: GCTTGCATGTTTGCACTCGTT), human DRP1 : (GCTACTTTACTCCAACTTATT), human MFN1 : (GCTCAAAGTTGTAAATGCTTT), and human MIRO2 : (CGTCTACAAGCACCATTACAT) were cloned into the pLKO.1 plasmid.

Techniques: Binding Assay, Transfection, Expressing, Western Blot, Immunoprecipitation, Stable Transfection, Staining, Confocal Microscopy, Infection, shRNA, Control, Construct, Flow Cytometry, Two Tailed Test